rs55793738 chr2:20584639 T>C
- Sequence
agaagctgatccagggcttcttgg[T/C]ttggtccgctaactgctcacctta
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) HKC8 (kidney proximal tubule cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.70 | -0.23 | 2.50 | |||
| HKC8 (kidney proximal tubule cell line) | -0.20 | 0.78 | 1.00 |
Items per page:
1 – 2 of 2