rs55809544 chr13:98466769 A>G
- Sequence
atgccaaatgttttctgcctctac[A/G]tggagatggcttatcaattcactc
- ASB in cell types
- osteoblasts CD34+ stem cells-derived erythroblasts foreskin keratinocyte pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| osteoblasts | n/a | 2.92 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.27 | -0.20 | 2.00 | |||
| foreskin keratinocyte | 0.67 | n/a | 2.33 | |||
| pancreas | 1.58 | -1.35 | 1.00 |
Items per page:
1 – 4 of 4