rs55814738 chr6:75932244 G>A
- Sequence
tgagaagttccagggaagggcaga[G/A]ccccaagggggagctattggacca
- ASB in cell types
- foreskin keratinocyte HCAEC (human coronary artery endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.50 | -4.46 | 2.00 | |||
| HCAEC (human coronary artery endothelial cells) | 2.27 | 0.10 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Nerve_Tibial, Pancreas, Thyroid, Whole_Blood