rs55816533 chr7:151124408 G>A
- Sequence
gggcctgccttcttccacacctcc[G/A]gtcttggattcctgcagtggacac
- ASB in cell types
- pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 2.12 | -1.78 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood