rs55818482 chr9:79130007 T>C
- Sequence
acaattaatttttgtgcagcccaa[T/C]tgcaatttgcaattctgatgcttt
- ASB in cell types
- foreskin keratinocyte GBM39 (Human brain tumor) HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.63 | n/a | 2.67 | |||
| GBM39 (Human brain tumor) | 1.48 | -0.32 | 1.50 | |||
| HMEC (human mammary epithelial cells) | -0.16 | 1.98 | 1.00 |
Items per page:
1 – 3 of 3