rs55819047 chr2:127035453 A>G
- Sequence
gtgccttccacaaggggcagcctc[A/G]gaggctcaagaggacatgcagggg
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 3.54 | -3.27 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Spinal_cord_cervical_c-1, Heart_Left_Ventricle, Lung, Thyroid, Whole_Blood