rs55821128 chr1:8849330 T>G
- Sequence
ccctgctctcatggcagggaaagc[T/G]gagctgcacctgcagaaggttggg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.80 | 0.78 | 1.40 | 0.54 | Weak Discordant | |||
| STAG1_HUMAN | 1.58 | 0.20 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
