rs55822333 chr15:100934954 A>G
- Sequence
tgatgttgaatctcaggtctgctc[A/G]gttgaccagaaggaggcagccaca
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) SYO-1(Biphasic synovial sarcoma) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 1.21 | -1.11 | 1.00 | |||
| SYO-1(Biphasic synovial sarcoma) | -2.00 | 2.37 | 1.00 | |||
| epithelial cell of prostate | 2.17 | n/a | 1.00 |
Items per page:
1 – 3 of 3