rs55825634 chr1:241423257 T>G
- Sequence
cacccactacccttactgtttttt[T/G]aatgtatatataactttattgagg
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 2.00 | -0.35 | 3.00 |
Items per page:
1 – 1 of 1