rs55836228 chr17:78559846 T>C
- Sequence
ccccactggcctccttgctgctcc[T/C]ggactgcaccaggctctcgggcgc
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) PANC1 (pancreatic ductal adenocarcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | -3.13 | 3.15 | 1.17 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -2.48 | 1.67 | 1.50 | |||
| HeLa S3 (cervical adenocarcinoma) | n/a | 2.83 | 2.00 |
Items per page:
1 – 3 of 3