rs55836238 chr3:14369749 C>A
- Sequence
gagcttgagaagaaatccaggaag[C/A]ctggtcagcctcagctcagcccca
- ASB in cell types
- gastrocnemius medialis
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastrocnemius medialis | 1.96 | -0.82 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood