rs55838212 chr8:104759816 A>G
- Sequence
ttgtttttgctgcaccatcaagct[A/G]tttggtcctgcttggtgttgaaac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- RAD21_HUMAN SMCA5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.37 | 0.27 | 2.00 | n/a | n/a | |||
| SMCA5_HUMAN | -1.84 | 2.21 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg