rs55842524 chr5:77645689 G>T
- Sequence
cccagggggcgcagcgcccgcagc[G/T]cggcctcctcccggcgtctcccgc
- ASB in cell types
- LUHMES (lund human mesencephalic cells) neural progenitors Kelly (neuroblastoma) HCT-116 (colon carcinoma)
- ASB for transcription factors
- EZH2_HUMAN CTCFL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 0.32 | 2.00 | 1.00 | n/a | n/a | |||
| CTCFL_HUMAN | 1.10 | -0.11 | 1.00 | -1.70 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
