rs55844267 chr9:2872848 A>T
- Sequence
cacttttcaatcgtggattttttt[A/T]atctaaaaaaaaaaaaaaggtttt
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) foreskin keratinocyte HEK293 (embryonic kidney) HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -3.85 | 2.20 | 1.50 | |||
| foreskin keratinocyte | 1.13 | n/a | 2.83 | |||
| HEK293 (embryonic kidney) | -0.78 | 1.80 | 1.00 | |||
| HUES64 (embryonic stem cells) | 1.33 | -0.39 | 1.00 |
Items per page:
1 – 4 of 4