rs55846016 chr2:85468804 T>C
- Sequence
taacttctctgttagttccacctc[T/C]cccactccctgcagcctgcagggt
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- TCF21_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.20 | n/a | 2.50 | n/a | No Hit | |||
| ANDR_HUMAN | 2.17 | -1.54 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic