rs55860328 chr13:114132059 G>A
- Sequence
gtggatttgacacctgaagtgcag[G/A]cgcccagacagcctcaggcgcgcg
- ASB in cell types
- GBM39 (Human brain tumor) OCI-LY1 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- KDM2B_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM2B_HUMAN | 2.17 | -1.82 | 1.00 | n/a | n/a | |||
| SMC3_HUMAN | 0.29 | 2.45 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Colon_Transverse, Thyroid, Whole_Blood