rs55861089 chr11:1762527 A>G
- Sequence
ttttcctggcttgtcaggggcgtg[A/G]tcccggaagatgagattattgcct
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 1.76 | 0.17 | 3.33 | |||
| breast tumor | 2.77 | -0.17 | 3.00 |
Items per page:
1 – 2 of 2