rs558684437 chr20:48657961 G>T
- Sequence
actctgcactcactcccagctact[G/T]tagccactgcagacagtgggtcct
- ASB in cell types
- WA01 (H1, human embryonic stem cells) SK-N-SH (neuroblastoma) HepG2 (hepatoblastoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 2.64 | -0.80 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1