rs55868790 chr14:55446557 T>C
- Sequence
atcagtcaatgtgaatatatgtgc[T/C]attttatacaaggaggtcctattt
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney) HeLa S3 (cervical adenocarcinoma) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.31 | 3.00 | |||
| HEK293 (embryonic kidney) | 0.49 | 0.86 | 1.13 | |||
| HeLa S3 (cervical adenocarcinoma) | -1.83 | 2.78 | 2.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 0.93 | -0.63 | 1.00 |
Items per page:
1 – 4 of 4