rs55869205 chr17:82668857 G>A
- Sequence
atcgagaggcccagccatgcctcc[G/A]ctgcagccggcatcttggcagcag
- ASB in cell types
- A549 (lung carcinoma) foreskin keratinocyte glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.18 | 0.28 | 2.99 | |||
| foreskin keratinocyte | 0.97 | n/a | 2.17 | |||
| glioblastoma cells | 1.98 | n/a | 2.00 |
Items per page:
1 – 3 of 3