rs560325746 chr7:149625690 A>G
- Sequence
ggctgaggatggagggcgccttgg[A/G]cgggggcccccacgtggttacaga
- ASB in cell types
- esophagus muscularis mucosa spleen upper lobe of left lung gastrocnemius medialis
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.11 | -0.17 | 1.05 | -0.18 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
