rs560404419 chr16:527416 T>C
- Sequence
cccacgcgtctgtgacgccgctga[T/C]gcgcagacgccgcggctgcaggcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) neural cell
- ASB for transcription factors
- CREB1_HUMAN SUZ12_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -4.07 | 1.66 | 4.67 | n/a | No Hit | |||
| SUZ12_HUMAN | n/a | 2.10 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Esophagus_Mucosa, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood