rs563403876 chr8:98037390 A>G
- Sequence
tctctctgccatgagactatgtat[A/G]tgtatatatatatatatatatata
- ASB in cell types
- 22RV1 (prostate carcinoma) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -2.65 | 2.99 | 1.00 | |||
| hepatocytes | 2.68 | -2.86 | 1.00 |
Items per page:
1 – 2 of 2