rs565370777 chr5:157743698 C>G
- Sequence
gccgcggctgcgcagtgccgccct[C/G]tggcggcttcgttccttcttccca
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.67 | 0.15 | 2.33 | -3.83 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
