rs565900824 chr7:54758992 G>C
- Sequence
cttccgccagaggccgagttggtg[G/C]gatgtcggcggccagaccccggcc
- ASB in cell types
- HCC1806(Squamous cell breast carcinoma, acantholytic variant)
- ASB for transcription factors
- BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD2_HUMAN | -1.80 | 2.59 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1