rs566358882 chr7:155297539 C>A
- Sequence
ccgcctcctcccggcaggaccgtc[C/A]cctcccaggccccagctccgcggc
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.89 | -2.19 | 1.33 | |||
| monocytes from periferal blood | 1.83 | n/a | 2.50 |
Items per page:
1 – 2 of 2