rs567450831 chr16:20741493 A>C
- Sequence
gcctggcagccggcccgcccgccc[A/C]ccccgggaccggtaccttttctgg
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.39 | 0.31 | 1.14 | n/a | n/a |
Items per page:
1 – 1 of 1