rs569271764 chr5:154755246 G>C
- Sequence
cgcctcctgcccgcccgtcgccca[G/C]ggcccggccagcggcgcgcccccg
- ASB in cell types
- BJ1-hTERT (Human fibroblast telomerase immortalized cell line)
- ASB for transcription factors
- EGR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | -1.56 | 2.10 | 1.00 | 4.35 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
