rs57014017 chr18:49768351 C>G
- Sequence
aagtcatcaatcactttataaaaa[C/G]aatttctcatttacaaaggcattc
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -3.73 | 1.56 | 2.00 | |||
| glioblastoma cells | -1.48 | 2.43 | 2.00 |
Items per page:
1 – 2 of 2