rs571312323 chr13:75348960 T>A
- Sequence
gagtagagagagagagagagtgtg[T/A]gtgtgtgtgtgtgtgtgtgtgtgt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 2.22 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1