rs5718 chr16:23182544 A>G
- Sequence
ggcactgcgcggtggcccaggaag[A/G]cgcagcgcggccgggctggggcgc
- ASB in cell types
- HepG2 (hepatoblastoma) IMR-5 (Neuroblastoma) T47D (invasive ductal carcinoma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.15 | 0.25 | 2.85 | |||
| IMR-5 (Neuroblastoma) | 3.19 | n/a | 1.50 | |||
| T47D (invasive ductal carcinoma) | 0.65 | 1.03 | 2.06 | |||
| erythroid progenitors | n/a | 2.25 | 2.00 | |||
| KB (cervical adenocarcinoma) | 1.19 | -0.30 | 1.50 |
Items per page:
1 – 5 of 9