rs573283605 chr15:63466760 G>C
- Sequence
agcctgtgttgggagaaccccccc[G/C]ccccttctcttgcagcttcccccg
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.23 | -1.96 | 1.00 | n/a | No Hit | |||
| STAG1_HUMAN | 2.16 | -1.96 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2