rs574378645 chr2:101725984 G>T
- Sequence
tggataaaagctgagtgttcttat[G/T]agtctcctgcatatctagtgcccc
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte ID00014 (lymphoblastoid cell, DiGeorge syndrome)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 2.13 | -1.83 | 3.36 | n/a | n/a | |||
| CTCF_HUMAN | 2.29 | -2.18 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2