rs574577759 chr11:16788625 A>G
- Sequence
ctgaggcctctgcactgcaagccc[A/G]gggagaccagtggcccttggggca
- ASB in cell types
- coronary artery right lobe of liver
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery | 1.77 | -1.53 | 1.00 | |||
| right lobe of liver | 0.99 | -0.99 | 1.00 |
Items per page:
1 – 2 of 2