rs574913882 chr16:6573835 C>G
- Sequence
accgtggggaggcagtgacacccg[C/G]tggcctcgcagcgacactccggca
- ASB in cell types
- D54 (H54, Human glioblastoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | n/a | 2.16 | 2.00 | 0.86 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
