rs5770772 chr22:50542785 C>T
- Sequence
agagcttccggaaggttgcggtgg[C/T]ctagggcgatccacgtcattgaga
- ASB in cell types
- monocyte-derived dendritic cells MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 2.98 | -5.49 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | -1.91 | 2.31 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood