rs5770871 chr22:50539833 G>A
- Sequence
acttcccaactagacagaccaaat[G/A]aggaagttgcataactgtaaccaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) macrophages monocyte-derived macrophages from peripheral blood MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- SRF_HUMAN SPI1_HUMAN CDK8_HUMAN STAT3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRF_HUMAN | -1.44 | 2.65 | 1.50 | 7.62 | Concordant | |||
| SPI1_HUMAN | 2.26 | -0.29 | 1.78 | -2.12 | Concordant | |||
| CDK8_HUMAN | 1.45 | -0.87 | 1.00 | n/a | n/a | |||
| STAT3_HUMAN | 2.46 | 0.00 | 1.83 | n/a | No Hit | |||
| ESR1_HUMAN | 2.86 | -5.08 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 9
Motif analysis
Genetic associations
GRASP hdl cholesterol, infant head circumference, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Vagina, Whole_Blood