rs58401148 chr1:44676623 T>G
- Sequence
aggcttatgactaatcaagtaaaa[T/G]aaggcctgaaagaatccactggat
- ASB in cell types
- THP-1 (acute monocytic leukemia) monocytes from periferal blood AML (monocytes and acute myeloid leukemia)
- ASB for transcription factors
- SPI1_HUMAN SRBP2_HUMAN MYB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.32 | 0.94 | 2.86 | n/a | No Hit | |||
| SRBP2_HUMAN | 2.29 | -0.82 | 2.67 | n/a | No Hit | |||
| MYB_HUMAN | 2.36 | -0.07 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid