rs58428160 chr17:45277314 G>A
- Sequence
ctattcctcccccctccccgctta[G/A]tagacttgtcctccttcctagctg
- ASB in cell types
- neutrophils from periferal blood epidermal keratinocytes neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 0.89 | 3.21 | 2.00 | |||
| epidermal keratinocytes | 2.05 | -1.04 | 2.00 | |||
| neutrophils | 2.23 | -0.13 | 1.50 |
Items per page:
1 – 3 of 3