rs58434233 chr10:132904422 G>T
- Sequence
ccgctgggacgcaatgacaccaag[G/T]gccactagaggacagcaatggtcc
- ASB in cell types
- epithelial cell of proximal tubule HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of proximal tubule | 2.82 | -2.71 | 1.00 | |||
| HMEC (human mammary epithelial cells) | 2.14 | 0.13 | 1.00 |
Items per page:
1 – 2 of 2