rs58460469 chr5:159965845 A>T
- Sequence
ggatctgaatttatttatttattt[A/T]tttatttttttgacacagaccagg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MCF10AT1 (breast premetastatic epithelial cells) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.94 | -1.01 | 1.00 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | -4.99 | 2.91 | 2.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.41 | -0.79 | 1.00 |
Items per page:
1 – 3 of 3