rs58475309 chr8:143219562 A>G
- Sequence
tcttcctgccccagaagaattcag[A/G]ccccttcgcctgtgctcatcacga
- ASB in cell types
- MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) | -0.71 | 1.89 | 3.00 |
Items per page:
1 – 1 of 1