rs58494418 chr12:107676347 C>T
- Sequence
gtgagctgagatcctgccattgca[C/T]tccagcctgggcaacaagagctaa
- ASB in cell types
- foreskin keratinocyte hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.63 | -2.94 | 1.67 | |||
| hepatocytes | 1.83 | -1.45 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood