rs58499983 chr2:134657658 T>C
- Sequence
ctctactaaatacaaaaaaattag[T/C]tgggcgtggtggcgcatgcctgta
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM19240 (B cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.78 | -0.77 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.69 | -0.40 | 1.50 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 1.49 | -1.29 | 1.00 |
Items per page:
1 – 3 of 3