rs58500868 chr19:51783560 A>G
- Sequence
ggttcctttcctgattactgcacc[A/G]ggactactcttattatggataaca
- ASB in cell types
- foreskin keratinocyte monocyte-derived dendritic cells MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 2.52 | 2.67 | |||
| monocyte-derived dendritic cells | 2.78 | -5.01 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | -1.65 | 1.95 | 1.00 |
Items per page:
1 – 3 of 3