rs58514208 chr9:127903747 C>T
- Sequence
accatggagtgggggcagggcggt[C/T]agacaggcaggaggcctgatgaac
- ASB in cell types
- primary B-CLL cells HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.40 | n/a | 4.00 | |||
| HepG2 (hepatoblastoma) | 0.64 | 0.67 | 1.12 |
Items per page:
1 – 2 of 2