rs58537733 chr6:43275284 C>T
- Sequence
agcgccccgcggcgccctgcaccc[C/T]ccgccggacttcggccccgccgcg
- ASB in cell types
- HepG2 (hepatoblastoma) bipolar neuron
- ASB for transcription factors
- RFOX2_HUMAN SMAD4_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFOX2_HUMAN | n/a | 2.73 | 2.00 | n/a | n/a | |||
| SMAD4_HUMAN | -4.83 | 2.42 | 2.00 | n/a | No Hit | |||
| CTCF_HUMAN | -1.71 | 1.78 | 1.00 | -0.79 | Weak Discordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid