rs58563808 chr17:40476334 G>T
- Sequence
actctctgcttcccccgtgtggct[G/T]tgaggctggttgaagccacatagc
- ASB in cell types
- foreskin keratinocyte GM12891 (male B- cells lymphoblastoid cell line) GM18486 (Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.11 | -0.46 | 1.69 | -1.19 | Weak Concordant | |||
| STAG1_HUMAN | 1.18 | -1.30 | 1.60 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid