rs58569120 chr10:46268924 A>G
- Sequence
agcatgcagcagatccccagccca[A/G]gggagagcgtcctgcccccatgct
- ASB in cell types
- J-Lat A72
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 1.57 | -0.96 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_EBV-transformed_lymphocytes, Spleen, Testis, Whole_Blood