rs58575768 chr5:69093779 G>A
- Sequence
acattttccacgccctccccctct[G/A]ccctacaggaatccgctgtacttc
- ASB in cell types
- erythroid cells neutrophils HCT-116-RAD21-mAC activated primary CD4+ T cells from blood
- ASB for transcription factors
- NFAC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFAC2_HUMAN | 2.03 | -1.19 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Nerve_Tibial, Thyroid